ID: 972640245_972640248

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 972640245 972640248
Species Human (GRCh38) Human (GRCh38)
Location 4:40918737-40918759 4:40918783-40918805
Sequence CCTCCTTCCTTATTTTTTCTCTG TTGTTTTTTTTAACAGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 143, 4: 1564} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!