ID: 972662871_972662877

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 972662871 972662877
Species Human (GRCh38) Human (GRCh38)
Location 4:41133754-41133776 4:41133781-41133803
Sequence CCACTGAAAAATTCTAGGCAGCT AACAAGGAGTGCAGAGTAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 190} {0: 1, 1: 0, 2: 8, 3: 24, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!