ID: 972663265_972663266

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 972663265 972663266
Species Human (GRCh38) Human (GRCh38)
Location 4:41138479-41138501 4:41138513-41138535
Sequence CCAATAAAGAGCTTATATCAGAC GAAACAACCCAATATAAAAATGG
Strand - +
Off-target summary No data {0: 2, 1: 8, 2: 146, 3: 742, 4: 3169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!