|
Left Crispr |
Right Crispr |
| Crispr ID |
972697658 |
972697666 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:41463924-41463946
|
4:41463966-41463988
|
| Sequence |
CCCAGTCTGATCTCAAACTCCAG |
GCTTAGCCTCACAAAGTGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 68, 2: 2625, 3: 27108, 4: 46998} |
{0: 1, 1: 128, 2: 7742, 3: 208627, 4: 313808} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|