ID: 972699246_972699248

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 972699246 972699248
Species Human (GRCh38) Human (GRCh38)
Location 4:41477889-41477911 4:41477912-41477934
Sequence CCATGAAGTAGGCATGTGGGGAT CACAGCTACCACCTTAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140} {0: 1, 1: 0, 2: 0, 3: 12, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!