|
Left Crispr |
Right Crispr |
| Crispr ID |
972701607 |
972701608 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:41499540-41499562
|
4:41499557-41499579
|
| Sequence |
CCGGGAGCGATGGCTCACGCCTA |
CGCCTATAATTCTAGCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 149, 2: 3773, 3: 47074, 4: 106840} |
{0: 35, 1: 1651, 2: 26709, 3: 188285, 4: 302850} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|