|
Left Crispr |
Right Crispr |
Crispr ID |
972701607 |
972701612 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:41499540-41499562
|
4:41499567-41499589
|
Sequence |
CCGGGAGCGATGGCTCACGCCTA |
TCTAGCACTTTGGAAGGGCAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 149, 2: 3773, 3: 47074, 4: 106840} |
{0: 2, 1: 21, 2: 1169, 3: 17926, 4: 122031} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|