ID: 972701607_972701613

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 972701607 972701613
Species Human (GRCh38) Human (GRCh38)
Location 4:41499540-41499562 4:41499570-41499592
Sequence CCGGGAGCGATGGCTCACGCCTA AGCACTTTGGAAGGGCAAGGTGG
Strand - +
Off-target summary {0: 7, 1: 149, 2: 3773, 3: 47074, 4: 106840} {0: 11, 1: 2503, 2: 64100, 3: 154424, 4: 160994}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!