ID: 972718491_972718501

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 972718491 972718501
Species Human (GRCh38) Human (GRCh38)
Location 4:41673138-41673160 4:41673186-41673208
Sequence CCCTTGATGTCCCCAGCCACAGT GCTCAGTCCCAAGCCAATACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 158} {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!