ID: 972746706_972746709

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 972746706 972746709
Species Human (GRCh38) Human (GRCh38)
Location 4:41940494-41940516 4:41940512-41940534
Sequence CCTGAGCACCTATTTTGCCAGTA CAGTATAAGAACTTGAATTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 76} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!