ID: 972814991_972814993

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 972814991 972814993
Species Human (GRCh38) Human (GRCh38)
Location 4:42634717-42634739 4:42634755-42634777
Sequence CCTGGCTCCTCATGCATATGCAA TTTTTATTATGAAATCAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126} {0: 1, 1: 0, 2: 6, 3: 68, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!