|
Left Crispr |
Right Crispr |
| Crispr ID |
972840149 |
972840152 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:42921243-42921265
|
4:42921259-42921281
|
| Sequence |
CCTCACCACACATGGAATCTGCT |
ATCTGCTGGTACCTTGATCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 15, 2: 66, 3: 502, 4: 1421} |
{0: 3, 1: 62, 2: 537, 3: 1518, 4: 2705} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|