ID: 972918158_972918166

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 972918158 972918166
Species Human (GRCh38) Human (GRCh38)
Location 4:43905324-43905346 4:43905357-43905379
Sequence CCTTTGCCGACAATGTAGGGTTG CCTGTTTGTTGTCTCAGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 6, 3: 34, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!