ID: 972918162_972918169

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 972918162 972918169
Species Human (GRCh38) Human (GRCh38)
Location 4:43905353-43905375 4:43905367-43905389
Sequence CCCTCCTGTTTGTTGTCTCAGGG GTCTCAGGGAAGGCTGCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 4, 3: 34, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!