ID: 972946483_972946490

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 972946483 972946490
Species Human (GRCh38) Human (GRCh38)
Location 4:44263053-44263075 4:44263106-44263128
Sequence CCTCTGCCCATGACAAGTCTAAA CTGCAGCAACGGAAAGCATATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124} {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!