ID: 972976607_972976616

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 972976607 972976616
Species Human (GRCh38) Human (GRCh38)
Location 4:44643668-44643690 4:44643711-44643733
Sequence CCCTCTTCCCTTCATAGCCTCAG GGCCACTCCAGCTCCAGCCTTGG
Strand - +
Off-target summary No data {0: 6, 1: 18, 2: 121, 3: 488, 4: 1305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!