ID: 973024595_973024602

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 973024595 973024602
Species Human (GRCh38) Human (GRCh38)
Location 4:45251500-45251522 4:45251519-45251541
Sequence CCATCCACCATCTAGAAATGGTG GGTGGGAGGCTGGAAACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!