ID: 973034997_973034999

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 973034997 973034999
Species Human (GRCh38) Human (GRCh38)
Location 4:45395254-45395276 4:45395270-45395292
Sequence CCAAAATCAAGGTGTCAGTAGAT AGTAGATTTGGTTACTTCTGAGG
Strand - +
Off-target summary {0: 3, 1: 11, 2: 189, 3: 907, 4: 2477} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!