ID: 973130191_973130193

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 973130191 973130193
Species Human (GRCh38) Human (GRCh38)
Location 4:46639698-46639720 4:46639725-46639747
Sequence CCAAGGGCTATCTCTCAAAAGGA AGTTATATTCAGAACATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 211, 3: 236, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!