ID: 973142676_973142685

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 973142676 973142685
Species Human (GRCh38) Human (GRCh38)
Location 4:46787969-46787991 4:46788012-46788034
Sequence CCTCTGATCCCCAACTCCTTCCT GTTTAGGACTTCAGGGACGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 56, 4: 535} {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!