ID: 973154928_973154931

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 973154928 973154931
Species Human (GRCh38) Human (GRCh38)
Location 4:46938993-46939015 4:46939046-46939068
Sequence CCTGGGAGATGGGAAAACCTCTT GCAACAAGTAAGTTTTAAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!