ID: 973207774_973207780

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 973207774 973207780
Species Human (GRCh38) Human (GRCh38)
Location 4:47579661-47579683 4:47579705-47579727
Sequence CCATGTTGCAGAATCAAAACGGC ATTGAGTGGGCAAACCATGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!