ID: 973279167_973279175

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 973279167 973279175
Species Human (GRCh38) Human (GRCh38)
Location 4:48341527-48341549 4:48341545-48341567
Sequence CCAATCCCGGAGCCGGCGCAGAT CAGATGAGGCAGTTCGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 27} {0: 1, 1: 1, 2: 0, 3: 9, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!