ID: 973279167_973279181

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 973279167 973279181
Species Human (GRCh38) Human (GRCh38)
Location 4:48341527-48341549 4:48341573-48341595
Sequence CCAATCCCGGAGCCGGCGCAGAT GGCGCTTTGGAACCCGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 27} {0: 1, 1: 0, 2: 2, 3: 19, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!