ID: 973296578_973296586

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 973296578 973296586
Species Human (GRCh38) Human (GRCh38)
Location 4:48529743-48529765 4:48529774-48529796
Sequence CCTCCCTTGGCTTCCGAAAGACC GGCACCAAGGCACCAAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 300, 4: 9769} {0: 1, 1: 0, 2: 2, 3: 14, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!