|
Left Crispr |
Right Crispr |
| Crispr ID |
973305094 |
973305099 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:48638757-48638779
|
4:48638786-48638808
|
| Sequence |
CCATGGAATACTATGCAGCCATA |
ATGTGTTCATGTCCTTTGCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 24516, 1: 14054, 2: 8260, 3: 5392, 4: 3574} |
{0: 1, 1: 117, 2: 5701, 3: 22242, 4: 9685} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|