ID: 973323228_973323236

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 973323228 973323236
Species Human (GRCh38) Human (GRCh38)
Location 4:48831185-48831207 4:48831224-48831246
Sequence CCTCCGGGCCTTCTGCCCCTGAT CAGTCGCCTGCTGCTGTCGTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 18, 4: 210} {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!