ID: 973339097_973339112

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 973339097 973339112
Species Human (GRCh38) Human (GRCh38)
Location 4:48986181-48986203 4:48986221-48986243
Sequence CCCGGCCTGGCCAGGCTCTGGCA TCGTGAAGGGGCGGGCGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 683} {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!