ID: 973339265_973339276

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 973339265 973339276
Species Human (GRCh38) Human (GRCh38)
Location 4:48986885-48986907 4:48986926-48986948
Sequence CCCAGGAGCTGTAGGTGGACACT TGGGCTGGGCCCAGGACAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 62, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!