ID: 973375081_973375099

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 973375081 973375099
Species Human (GRCh38) Human (GRCh38)
Location 4:49280924-49280946 4:49280976-49280998
Sequence CCACATCCCTGGTGAGGAGCTGC AGGGAGAAGCTGGGTGAGGCAGG
Strand - +
Off-target summary No data {0: 32, 1: 6, 2: 5, 3: 100, 4: 828}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!