ID: 973382312_973382329

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 973382312 973382329
Species Human (GRCh38) Human (GRCh38)
Location 4:49329265-49329287 4:49329311-49329333
Sequence CCTGCCTCACCCAGCTTCTCCCT CAAGGGGCAGCTCCTCACCAGGG
Strand - +
Off-target summary No data {0: 26, 1: 9, 2: 27, 3: 25, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!