ID: 973386877_973386886

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 973386877 973386886
Species Human (GRCh38) Human (GRCh38)
Location 4:49518989-49519011 4:49519039-49519061
Sequence CCTGGGTCCCAGTGCAGGGACTG ACCCAGGCCGTGTTTCTCCGCGG
Strand - +
Off-target summary {0: 11, 1: 11, 2: 21, 3: 74, 4: 458} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!