ID: 973532167_973532176

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 973532167 973532176
Species Human (GRCh38) Human (GRCh38)
Location 4:51844377-51844399 4:51844400-51844422
Sequence CCCCCCGGACGGCGGGAAGCGAG GTCAGCGCTGGCGCGGGCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 61} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!