ID: 973551292_973551302

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 973551292 973551302
Species Human (GRCh38) Human (GRCh38)
Location 4:52038292-52038314 4:52038325-52038347
Sequence CCGACTGTGCCCGCCCCTCCGCG GCGCGCCTGCGCTTGCGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 208} {0: 1, 1: 0, 2: 0, 3: 14, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!