ID: 973567483_973567485

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 973567483 973567485
Species Human (GRCh38) Human (GRCh38)
Location 4:52202713-52202735 4:52202731-52202753
Sequence CCTTGACCACTACAGAGTTTTCA TTTCAGTTTATTAACACTACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 19, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!