ID: 973613556_973613571

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 973613556 973613571
Species Human (GRCh38) Human (GRCh38)
Location 4:52658895-52658917 4:52658935-52658957
Sequence CCGAGGTCCCGGGGCTGAGACGG ACCCTCCCCGGCCGCTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 178} {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!