ID: 973635865_973635877

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 973635865 973635877
Species Human (GRCh38) Human (GRCh38)
Location 4:52861925-52861947 4:52861965-52861987
Sequence CCGCCCAGAGCAGACGCCCTAGG GCGCGCGTGGGCTGTGGAGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!