ID: 973658835_973658836

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 973658835 973658836
Species Human (GRCh38) Human (GRCh38)
Location 4:53081080-53081102 4:53081117-53081139
Sequence CCTGTAAATGCAACACATGATTA CACACGTGAAGCAGAATTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 168} {0: 1, 1: 0, 2: 1, 3: 10, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!