ID: 973733901_973733909

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 973733901 973733909
Species Human (GRCh38) Human (GRCh38)
Location 4:53851167-53851189 4:53851211-53851233
Sequence CCCAGTCCCATCTGTTTTCACCC AACAGTTATTAAAAGTTTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 249} {0: 1, 1: 0, 2: 4, 3: 37, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!