ID: 973737388_973737399

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 973737388 973737399
Species Human (GRCh38) Human (GRCh38)
Location 4:53885870-53885892 4:53885902-53885924
Sequence CCTGGGCCAAAAGGCTCCCTGAG CTGGAGTCTGGACTGGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 201} {0: 1, 1: 0, 2: 1, 3: 29, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!