ID: 973737394_973737399

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 973737394 973737399
Species Human (GRCh38) Human (GRCh38)
Location 4:53885886-53885908 4:53885902-53885924
Sequence CCCTGAGGAGGGCTCTCTGGAGT CTGGAGTCTGGACTGGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 208} {0: 1, 1: 0, 2: 1, 3: 29, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!