ID: 973754896_973754904

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 973754896 973754904
Species Human (GRCh38) Human (GRCh38)
Location 4:54064749-54064771 4:54064785-54064807
Sequence CCTCGCGCGCTCCCAGGCCACCG TCTACCCGCAGACGGCGACCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 208} {0: 1, 1: 0, 2: 0, 3: 2, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!