ID: 973754900_973754910

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 973754900 973754910
Species Human (GRCh38) Human (GRCh38)
Location 4:54064769-54064791 4:54064805-54064827
Sequence CCGTCTTTCCTCTGCTTCTACCC GGGGCGCGCGCTCCCGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 106, 4: 864} {0: 1, 1: 0, 2: 1, 3: 20, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!