ID: 973754906_973754926

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 973754906 973754926
Species Human (GRCh38) Human (GRCh38)
Location 4:54064789-54064811 4:54064841-54064863
Sequence CCCGCAGACGGCGACCGGGGCGC GACTTCTGGGTGGCGGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 83} {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!