ID: 973761258_973761261

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 973761258 973761261
Species Human (GRCh38) Human (GRCh38)
Location 4:54117710-54117732 4:54117741-54117763
Sequence CCCTATTGAGTATGGCTGGAAGC AAATCATTTGACCATATGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80} {0: 1, 1: 1, 2: 6, 3: 47, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!