ID: 973865396_973865403

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 973865396 973865403
Species Human (GRCh38) Human (GRCh38)
Location 4:55107852-55107874 4:55107881-55107903
Sequence CCACAGGAGAGATTAGAGATTTC ATCTGGGGTGGGACTGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 166} {0: 1, 1: 0, 2: 3, 3: 23, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!