ID: 973884471_973884475

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 973884471 973884475
Species Human (GRCh38) Human (GRCh38)
Location 4:55306603-55306625 4:55306616-55306638
Sequence CCAACAAGTAGGCAAGAAAGCAC AAGAAAGCACAGGCGGAACTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!