ID: 973894696_973894697

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 973894696 973894697
Species Human (GRCh38) Human (GRCh38)
Location 4:55399820-55399842 4:55399840-55399862
Sequence CCTTCTGAGTAGCTGGGAAGGGA GGATCCTTGTCTTTAAAACTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 23, 3: 561, 4: 12405} {0: 1, 1: 0, 2: 1, 3: 20, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!