ID: 973895507_973895512

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 973895507 973895512
Species Human (GRCh38) Human (GRCh38)
Location 4:55408647-55408669 4:55408682-55408704
Sequence CCCTACATTTTACAGAGGAACAG GTGGCTGAAGTTTCATGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 297} {0: 1, 1: 0, 2: 2, 3: 14, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!