ID: 973938277_973938282

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 973938277 973938282
Species Human (GRCh38) Human (GRCh38)
Location 4:55874479-55874501 4:55874531-55874553
Sequence CCCTTATGAAGGACTCACTTCTT CAGGAAAAACATCTTGCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 215} {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!